CRAN Package Check Results for Package TrustVDJ

Last updated on 2023-01-25 04:51:51 CET.

Flavor Version Tinstall Tcheck Ttotal Status Flags
r-devel-linux-x86_64-debian-clang 0.1.0 17.71 153.39 171.10 OK
r-devel-linux-x86_64-debian-gcc 0.1.0 15.44 112.22 127.66 OK
r-devel-linux-x86_64-fedora-clang 0.1.0 212.42 OK
r-devel-linux-x86_64-fedora-gcc 0.1.0 206.93 OK
r-devel-windows-x86_64 0.1.0 30.00 0.00 30.00 FAIL
r-patched-linux-x86_64 0.1.0 19.26 145.86 165.12 OK
r-release-linux-x86_64 0.1.0 14.80 145.87 160.67 OK
r-release-macos-arm64 0.1.0 58.00 OK
r-release-macos-x86_64 0.1.0 75.00 OK
r-release-windows-x86_64 0.1.0 36.00 0.00 36.00 FAIL
r-oldrel-macos-arm64 0.1.0 54.00 OK
r-oldrel-macos-x86_64 0.1.0 67.00 OK
r-oldrel-windows-ix86+x86_64 0.1.0 40.00 183.00 223.00 OK

Check Details

Version: 0.1.0
Check: examples
Result: FAIL
    Check process probably crashed or hung up for 20 minutes ... killed
    Most likely this happened in the example checks (?),
    if not, ignore the following last lines of example output:
    6 NA NA
     junction junction_aa
    1 TGTGCCAGCAGTGAAAGACATGCCACAGATACGCAGTATTTT CASSERHATDTQYF
    2 TGCGCCAGCAGTGTTCGTCCTAGCGGGGACAGCACAGATACGCAGTATTTT CASSVRPSGDSTDTQYF
    3 TGTGCCAGCACTCTAGCGGCTAGCACAGATACGCAGTATTTT CASTLAASTDTQYF
    4 TGTGCCAGCAGCTTGAGGGGGGCGGATACGCAGTATTTT CASSLRGADTQYF
    5 TGCAGTGCCGCAACCCTAGTCCTAGCGGGGGGCCAGGGCACAGATACGCAGTATTTT CSAATLVLAGGQGTDTQYF
    6 TGCGCCAGCAGCCAAGATAGGGTGGGGCTAGCGGGGGATACGCAGTATTTT CASSQDRVGLAGDTQYF
     v_cigar d_cigar j_cigar v_identity j_identity cell_id
    1 56M107S 64S47M52S 100 100 CTCGTCATCGTTGCCT
    2 281M120S 289S9M103S 300S49M52S 100 100 AGTGTCAGTCGAAAGC
    3 280M112S 282S7M103S 291S49M52S 100 100 ACTGAACAGCCACCTG
    4 60M105S 63S6M96S 70S43M52S 100 100 CAGTCCTGTTATCACG
    5 24M129S 37S11M105S 53S48M52S 100 100 TTTGGTTCATCCGGGT
    6 103M114S 109S14M94S 122S43M52S 100 100 GTATCTTGTCAACTGT
     complete_vdj consensus_count
    1 F 1
    2 T 4
    3 T 3
    4 F 4
    5 F 1
    6 F 9
    >
    > # only barcode_report
    >
    > # only report
    > data = ReadTrust(report_file = report_file)
    --! 2023-01-21 13:39:08.804421 Ignored AIRR report file due to no exist: NA !--
    --! 2023-01-21 13:39:08.804759 Ignored TRUST4 barcode_report file due to no exist: NA !--
    --> 2023-01-21 13:39:08.805501 Reading: D:/RCompile/CRANpkg/lib/4.3/TrustVDJ/extdata/TRUST4_report.tsv.gz <--
    ======== End of example output (where/before crash/hang up occured ?) ========
Flavor: r-devel-windows-x86_64

Version: 0.1.0
Check: examples
Result: FAIL
    Check process probably crashed or hung up for 20 minutes ... killed
    Most likely this happened in the example checks (?),
    if not, ignore the following last lines of example output:
    4
    5
    6 TRB:gene
    >
    >
    >
    >
    > cleanEx()
    > nameEx("ReadTrust")
    > ### * ReadTrust
    >
    > flush(stderr()); flush(stdout())
    >
    > ### Name: ReadTrust
    > ### Title: Read AIRR/TRUST4 report files
    > ### Aliases: ReadTrust
    >
    > ### ** Examples
    >
    >
    > # file paths
    > airr_file = system.file('extdata', 'TRUST4_airr.tsv.gz', package = 'TrustVDJ')
    > barcode_report_file = system.file('extdata', 'TRUST4_barcode_report.tsv.gz', package = 'TrustVDJ')
    > report_file = system.file('extdata', 'TRUST4_report.tsv.gz', package = 'TrustVDJ')
    >
    > # both AIRR and barcode_report
    >
    > # only AIRR
    > data = ReadTrust(airr_file = airr_file)
    --> 2023-01-22 20:57:00 Reading: D:/RCompile/CRANpkg/lib/4.2/TrustVDJ/extdata/TRUST4_airr.tsv.gz <--
    ======== End of example output (where/before crash/hang up occured ?) ========
Flavor: r-release-windows-x86_64